View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9443_low_4 (Length: 291)
Name: NF9443_low_4
Description: NF9443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9443_low_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 12 - 291
Target Start/End: Original strand, 31828379 - 31828660
Alignment:
| Q |
12 |
agcataggggtgtctctgaggtacaactgggaagtgtttgcttactgagttcttggtttgcaaggtggatcaagtgtcagaggttttgttcacggtctaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31828379 |
agcataggggtgtctctgaggtacaactgggaagtgtttgcttactgagttcttggtttgcaaggtggatcaagtgtcagaggttttgttcatggtctaa |
31828478 |
T |
|
| Q |
112 |
tcgtgttttgtccattcgtgttcgccattgtgtggctggtagcaggacatttgcaggagcagctccgctagtgaatagac--tgcagaatatgcagctgc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31828479 |
tcgtgttttgtccattcgtattcgccattgtgtggcaggtagcaggacttttgcaggagcagctccgctagtgaatagactgtgcagaatatgcagctgc |
31828578 |
T |
|
| Q |
210 |
agttctatctgtgtcttgacttagaaacgggagtagcagtatgtgatcgttgcgatttcatagggcgggcgcaggagcgggt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828579 |
agttctatctgtgtcttgacttagaaacgggagtagcagtatgtgatcgttgcgatttcatagggcgggcgcaggagcgggt |
31828660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University