View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_high_44 (Length: 244)
Name: NF9444_high_44
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_high_44 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] scaffold0475 (1 HSPs) |
| | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 244
Target Start/End: Original strand, 26131336 - 26131575
Alignment:
| Q |
5 |
gtggtgatagatattgaaaaggatgatgatgtgcctctgattcttggaaggatctttatgcaaactgcgagagtgatgattgacctcgatgacagattat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26131336 |
gtggtgatagatattgaaaaggatgatgatgtgcctctgattcttggaaggacctttatgcaaactgtgagagtgatgattgacctcgatgacagattaa |
26131435 |
T |
|
| Q |
105 |
tgaagatccgagttgagaatgaagaggtaaacttcaatttatttgaagttatgaagcattctaaagacaagggagcttgtttcaagatggatgcggttga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26131436 |
tgaagatccgagttgagaatgaagaggtaaacttcaatttatttgaagttatgaagcattctaaagacaagggagcttgtttcaagatggatgcgattga |
26131535 |
T |
|
| Q |
205 |
tgacgtaatcatggatacgaggaagcagttgcacatgccg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26131536 |
tgacgtaatcatggatacgaggaagcagttgcacatgccg |
26131575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0475 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0475
Description:
Target: scaffold0475; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 90 - 172
Alignment:
| Q |
155 |
atgaagcattctaaagacaagggagcttgtttcaagatggatgcggttgatgacgtaatcatggatacgaggaagcagttgca |
237 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||| ||||||| | ||||| || |||||||| || ||||| || ||||| |
|
|
| T |
90 |
atgaagcactccaaagacaaaggagcttgtttcaaggtggatgcaatggatgaagtcatcatggaaacaaggaaacaattgca |
172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 1124 - 1206
Alignment:
| Q |
155 |
atgaagcattctaaagacaagggagcttgtttcaagatggatgcggttgatgacgtaatcatggatacgaggaagcagttgca |
237 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||| ||||||| | ||||| || |||||||| || ||||| || ||||| |
|
|
| T |
1124 |
atgaagcactccaaagacaaaggagcttgtttcaaggtggatgcaatggatgaagtcatcatggaaacaaggaaacaattgca |
1206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 14296252 - 14296170
Alignment:
| Q |
155 |
atgaagcattctaaagacaagggagcttgtttcaagatggatgcggttgatgacgtaatcatggatacgaggaagcagttgca |
237 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||| ||||||| | ||||| || |||||||| || ||||| || ||||| |
|
|
| T |
14296252 |
atgaagcactccaaagacaaaggagcttgtttcaaggtggatgcaatggatgaagtcatcatggaaacaaggaaacaattgca |
14296170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 7065341 - 7065423
Alignment:
| Q |
155 |
atgaagcattctaaagacaagggagcttgtttcaagatggatgcggttgatgacgtaatcatggatacgaggaagcagttgca |
237 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||| ||||||| | ||||| || |||||||| || ||||| || ||||| |
|
|
| T |
7065341 |
atgaagcactccaaagacaaaggagcttgtttcaaggtggatgcaatggatgaagtcatcatggaaacaaggaaacaattgca |
7065423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University