View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_high_49 (Length: 225)
Name: NF9444_high_49
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 14 - 207
Target Start/End: Complemental strand, 45674141 - 45673947
Alignment:
| Q |
14 |
cagagataagataaatatttcattcacgtctttctaatctggaaatgtattgtattgtacgcaatcaaaagctgttgaattctttaattcccatgagctc |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45674141 |
cagagataagaaaaatatttcattcacgtctttctaatctggtaatgtattgtattgtacgcaatcaaaagctgttgaattctttaattcccatgagctc |
45674042 |
T |
|
| Q |
114 |
aatgatgattgattaaattgattctatttatgtagtacgac-nnnnnnncttcagaaaatatatgccatgccaccgactaattctctgcaataaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
45674041 |
aatgatgattgattaaattgattctatttatgtagtaggacaaaaaaaacttcagaaaatatatgccatgccaccgactaattatgtgcaataaa |
45673947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University