View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_107 (Length: 250)
Name: NF9444_low_107
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_107 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 18700994 - 18701234
Alignment:
| Q |
1 |
tcttctatattttacattgtcttggaaactttactttagtcttctaaagggccgcataattttgtagatttgtgtattgttctacatatttgttgctttt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18700994 |
tcttctatattttacattttcttggaaactttactttagtcttctaaagggctgcataattttgtagatttgtgtattgttctacatatttgttgctttt |
18701093 |
T |
 |
| Q |
101 |
aatactctaggaatacataataacactaacatattctgtgtgagatcaaccatcttttcaatgacatgtataaggtggctgctctgttgatcaaacttaa |
200 |
Q |
| |
|
|||||||||| |||||||||||| | |||||| |||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18701094 |
aatactctagcaatacataataatattaacatcttctatgtgagttcaatcatcttttcaatgacatgtataaggtggctgctctgttgatcaaacttaa |
18701193 |
T |
 |
| Q |
201 |
gtgctttggtatactatttctgtttcaatttgaagaattat |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18701194 |
gtgctttggtatactatttctatttcaatttgaagaattat |
18701234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University