View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_109 (Length: 248)
Name: NF9444_low_109
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_109 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 27 - 149
Target Start/End: Complemental strand, 37865969 - 37865847
Alignment:
| Q |
27 |
ggtggcgaaaacaataaagatggcgagatttatggtgaatttaacaggggaagtttctatatagtgaatgctggcgagatttccggttgctttaagtgtt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37865969 |
ggtggcgaaaacaataaagatggcgagattttcggtgaatttaacaggggaagtttctatatagtgaatgctgacgagatttccggttgctttaagtgtt |
37865870 |
T |
|
| Q |
127 |
tatttcatataaaagtaataaca |
149 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
37865869 |
tatttcatataaaagcaataaca |
37865847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 37865825 - 37865786
Alignment:
| Q |
183 |
gtcgtgtgtgctatttgtcgtgtacaatagcagtgctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865825 |
gtcgtgtgtgctatttgtcgtgtacaatagcagtgctcat |
37865786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University