View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_111 (Length: 247)
Name: NF9444_low_111
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_111 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 7 - 230
Target Start/End: Original strand, 27261116 - 27261329
Alignment:
| Q |
7 |
ttggtgttggtggcgtttccttggactgattccaaatcgcagacaaaagccatcggaaaggccagtttttatcgttgaagacggaggattcggcagatca |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27261116 |
ttggtggtggtggcgtttccttggactgattccaaatcgcagacaaaagccatcggaaaggccagtttttatcgttgaagacggaggattcggcagatca |
27261215 |
T |
|
| Q |
107 |
ctaattcgttaactttcgtttttctcatgaccgtgagattgaatccaatagaaattgccttttcacggtttcgaggaagcagatggaaatagaggatgtt |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27261216 |
ctaa----------ttcgtttttctcatgaccgtgagattgaatccaatagaaattgccttttcacggtttcgaggaagcagatggaaatggaggatgtt |
27261305 |
T |
|
| Q |
207 |
gatgtgagagttgagaaggaggat |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27261306 |
gatgtgagagttgagaaggaggat |
27261329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University