View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_120 (Length: 233)
Name: NF9444_low_120
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_120 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 22 - 218
Target Start/End: Original strand, 53664975 - 53665171
Alignment:
| Q |
22 |
atgggtttgaaggtacctagtgggaagacgatagaaatgcgcccaaagatcatcctcaaaaccgggagccataatctcaggaacattcaattccctaagt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53664975 |
atgggtttgaaggtacctagtgggaagacgatagaaatgcgcccaaagatcatcctcaaaaccgggagccataatctcaggaacattcaattccctaagt |
53665074 |
T |
|
| Q |
122 |
cgactaagaactttgaggtaaacttcaatcttttgtttctgctttccattttgattccattcagaactgacaactttgatattacaacaactctctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
53665075 |
cgactaagaactttgaggtaaacttcaatcttttgtttctgctttccattttgattccattcagaactgatagctttgatattgcaacaactctctg |
53665171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University