View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_125 (Length: 230)
Name: NF9444_low_125
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_125 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 15 - 84
Target Start/End: Original strand, 29645602 - 29645671
Alignment:
| Q |
15 |
catagggagataggaatatacacattcaagtcaatatggccagccttttaaattcaaagaatctcaattg |
84 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29645602 |
catagggagataggaatatacacaatcaagtcgatatggccagccttttaaattcaaagaatctcaattg |
29645671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 151 - 214
Target Start/End: Original strand, 29645741 - 29645804
Alignment:
| Q |
151 |
cttcatgtatgcaatgcagcttgcaatttctattgcacttcccatggcactccaatgttcaatt |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29645741 |
cttcatgtatgcaatgcagattgcaatttctattgcacttcccatggcactccaatgtgcaatt |
29645804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University