View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_134 (Length: 218)
Name: NF9444_low_134
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_134 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 29356454 - 29356270
Alignment:
| Q |
18 |
acaaacagaaaacacaggaaatttgataatagatttcggtcaattgtgcccatgtctccgactatagagtggttgcatgcctactattcaaggttagggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29356454 |
acaaacagaaaacacaggaaatttgataatagatttcggtcaattgtgtccacgtctccgactatagagtggttgcatgcctactattcaaggttagggt |
29356355 |
T |
 |
| Q |
118 |
taaatactgcggtttagcttacaagattacccttgaaacgctagctcggtcttatcaattgtaatttgttagttttcttaccttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29356354 |
taaatactgcggtttagcttacaagattacccttgaaacgctagctcggtcttatcaattgtaatttgttagttttcttaccttc |
29356270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 25530364 - 25530430
Alignment:
| Q |
20 |
aaacagaaaacacaggaaatttgataatagatttcggtcaattgtgcccatgtctccgactatagag |
86 |
Q |
| |
|
|||||||||||||| || ||||||||| ||| ||||| ||||||| || ||| |||||||| ||||| |
|
|
| T |
25530364 |
aaacagaaaacacacgatatttgataacagagttcggccaattgtccctatgcctccgactgtagag |
25530430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University