View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_138 (Length: 212)
Name: NF9444_low_138
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_138 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 35519611 - 35519431
Alignment:
| Q |
13 |
tttggtgttcaaccaaaaattgctgtagctgatcagcagacaatgctgatccgccattggcgaattcggaaaaaacttccttgacatcagatggtggtaa |
112 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35519611 |
tttgatgttcaaccaaaaattgccgtagctgatcagcagacaatgctgatccgccgttggagaattcggaaaaaacttccttgacatcagatggtggtaa |
35519512 |
T |
|
| Q |
113 |
ttgttcttgttcggagaatgagatatttctgttgaaacatttgaacattttgtaacgtagttgaatgtgttgaatatgatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35519511 |
ttgttcttgttcggagaatgagatatttctgttgaaacgtttgaacattttgtaacgcagttgaatgtgttgaatatgatt |
35519431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University