View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_26 (Length: 412)
Name: NF9444_low_26
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 18 - 407
Target Start/End: Complemental strand, 42192571 - 42192182
Alignment:
| Q |
18 |
aaaagccccatacatcctccaacaggagtgttccggcaccgcgttaggcctagctcggtgattatcctctccgcgtgttcgaccttttcttcgcgggtaa |
117 |
Q |
| |
|
||||| |||||||| || ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
42192571 |
aaaagtcccatacagccgccaacctgagtgttccggcaccgcgttaggccgagctcggtgattatcctctccgcgtgttcgaccttttcttcacgcgtaa |
42192472 |
T |
 |
| Q |
118 |
gtgtcttgggaagtctcaagagtgcggtgtaggttaatgtttccaacaccgttaagtgagggtaaactacgtcgtcttgagaaacaaaacctattttgcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42192471 |
gtgtcttgggaagtctcaagagtgcggtgtaggttaatgtttccaacaccgttaagtgagggtaaactacatcgtcttgagaaacaaaacctattttgcg |
42192372 |
T |
 |
| Q |
218 |
tttcatgcaggatgagtctgagtttccgttgtatgttattgttccggtgacttttccggcaagtcttccggctaaggccgttagtagggtggttttgccg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42192371 |
tttcatgcaggatgagtctgagtttccgttgtatgttatggttccagtgacttttccggcaagtcttccggctaaggccgttagtagggtggttttgcca |
42192272 |
T |
 |
| Q |
318 |
ctccctgagggtcctagcattgctgttaactcgccgggtcttgctactccagtgactccgttgaggatttttcttgttacctttgcttct |
407 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
42192271 |
ctccctgagggtcctaacattgctgttaactcgccgggtcttgctactccggtgactccgttgaggatttttcttgttacttttgattct |
42192182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University