View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_45 (Length: 333)
Name: NF9444_low_45
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 18 - 312
Target Start/End: Original strand, 180897 - 181191
Alignment:
| Q |
18 |
tggtcccgaagaagttcagattggtgatggtacaggtttgaaaatttcacatgttggctctattaccctccctacccccaatattactttcaaattaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
180897 |
tggtcccgaagaagttcagattggtgatggtacaggtttgaatatttcacatgttggctctattaccctccctaccccaaatattactttcaaattaaat |
180996 |
T |
|
| Q |
118 |
aaggtgctttgtgtcccaaatgctaaacataatctcatatctgttaagaaattctgcaagtctaacaatacatatcttgaatttcaccctacctttttct |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
180997 |
aatgtgctttgtgtcccaaatgctaaacataatctcatatatgttaagaaattctgcaagtctaacaatacatatcttgaattgcaccctacctttttct |
181096 |
T |
|
| Q |
218 |
gtgtgaaggatcaggtcacgggggtgacgttgatgcgcggttcaagtaacagtgatctctacacctttcattatatgtctcaatatcaacccact |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
181097 |
gtgtgaaggatcaggtcacgggggtgacgttgatgcgcggttccagtaacagtgatctctacacctttcattatatgtctcaatatcaacccact |
181191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 19 - 312
Target Start/End: Original strand, 1701325 - 1701618
Alignment:
| Q |
19 |
ggtcccgaagaagttcagattggtgatggtacaggtttgaaaatttcacatgttggctctattaccctccctacccccaatattactttcaaattaaata |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1701325 |
ggtccagaagaagttcagattggtgatggtacaggtttgaaaatttcacatgttggctctattaccctccctacccccaatactactttcaaattaaata |
1701424 |
T |
|
| Q |
119 |
aggtgctttgtgtcccaaatgctaaacataatctcatatctgttaagaaattctgcaagtctaacaatacatatcttgaatttcaccctacctttttctg |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1701425 |
atgtgctttgtgtcccaaatgctaaacataatctcatatatgttaagaaattctgcaagtctaacaatacatatcttgaatttcaccctacctttttctg |
1701524 |
T |
|
| Q |
219 |
tgtgaaggatcaggtcacgggggtgacgttgatgcgcggttcaagtaacagtgatctctacacctttcattatatgtctcaatatcaacccact |
312 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
1701525 |
tgtaaaggatcaggtcacgggggcgacgttgatgcgcggttcaagtaacagtgatctctacacctttcatcctaagtctcaatatcaacccact |
1701618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 5400063 - 5400124
Alignment:
| Q |
18 |
tggtcccgaagaagttcagattggtgatggtacaggtttgaaaatttcacatgttggctcta |
79 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
5400063 |
tggtcccgaggaagttcaaattggtgatggtacaggtttaaaaatttctcatgttggctcta |
5400124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 3541060 - 3541121
Alignment:
| Q |
18 |
tggtcccgaagaagttcagattggtgatggtacaggtttgaaaatttcacatgttggctcta |
79 |
Q |
| |
|
|||||| || |||||||| |||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
3541060 |
tggtccagaggaagttcaaattggtgatggtacaggtttaaaaatttctcatgttggctcta |
3541121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 74
Target Start/End: Complemental strand, 26593102 - 26593053
Alignment:
| Q |
25 |
gaagaagttcagattggtgatggtacaggtttgaaaatttcacatgttgg |
74 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26593102 |
gaagaagtgcaaattggtgatggtacaggtttgaaaatttcccatgttgg |
26593053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University