View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_48 (Length: 328)
Name: NF9444_low_48
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 313
Target Start/End: Original strand, 24305241 - 24305540
Alignment:
| Q |
17 |
attaataaccaaaattacctacttttgaataatttatgtaataagtatttttgggtttagggtgtcatattagtagtatcgaagcctatatttttcaata |
116 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24305241 |
attaataaaaaaaattacatacttttgaataatttatgtaataagtatttt-gggtttagggtgtcatattagtagtatcgaagcctatatttttcatta |
24305339 |
T |
 |
| Q |
117 |
ggcttacgtatgttatgtgtctactatgtttaagtaacttcattccttttaacgcaatcgcttgataatgtcnnnnnnnnnnnnnnnnnnnnggttgtgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24305340 |
ggcttacgtatgttatgtgtctactatgtttaagtaacttcattccttttaacgcaatcgcttgataatgtctaaaaaataataaaaataatggttgtgt |
24305439 |
T |
 |
| Q |
217 |
atat----atgttagatgttattgtacaattttgagtcattgtcgtatgtcttgtgccttttttatgaaatgattttgaagccctatagattgttgaaca |
312 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24305440 |
atatatgcatgttagatgttattgtacaattttgtgtcattgttgtatgtcttgtgccttttttatgaaatgattttgaagccctatagattgttgaaca |
24305539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University