View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_60 (Length: 317)
Name: NF9444_low_60
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 30 - 305
Target Start/End: Original strand, 47223089 - 47223367
Alignment:
| Q |
30 |
atagatatcacataagattagttgctaaaaaatttagtgactaaattgagttggacacggctcacaaatacatgtta---gtgtttaagaaacacaaagt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47223089 |
atagatatcacataagattagttgctaaaaaatttagtgactaaattgagttggacacggctcacaaatacatgttactagtgtttaagaaacacaaagc |
47223188 |
T |
 |
| Q |
127 |
taactaacgcgttcgtgtactagttggcttcccaataagaatatttcactgctacctctcaatctatctctaaaaggtgataaatcttcttaaccaaaga |
226 |
Q |
| |
|
||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47223189 |
taactaacgcgttagcgcactagttggcttcccaataagaatatttcactgctacctctcaatctatctctaaaaggtgataaatcttcttaaccaaaga |
47223288 |
T |
 |
| Q |
227 |
tcgtctcacaaaacttttgtgtataactggtaagaacatcatcaaccactgctaacgaatccacgttaagttcgataac |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47223289 |
tcgtctcacaaaacttttgtgtataactggtaagaacatcatcaaccactgctaacgaatccacgttaagttcgataac |
47223367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University