View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_67 (Length: 306)
Name: NF9444_low_67
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 1445228 - 1444998
Alignment:
| Q |
17 |
aagttttgtctttgaaaccagtgattttgctctgtcctgttctcagttaacattaatgnnnnnnnataaatatcactaaaagcatttttctctattaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445228 |
aagttttgtctttgaaaccagtgattttgctctgtcctgttctcagttaacattaatgtttttttataaatatcactaaaagcatttttctctattaaaa |
1445129 |
T |
|
| Q |
117 |
atatcaaatgtatagatcttacaaacttgttgattatgtgcggtgcggtatataacatgaacttcaatttgccaaacaaaattcccttactttatggtta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445128 |
atatcaaatgtatagatcttacaaacttgttgattatgtgcggtgcggtatataacatgaacttcaatttgccaaacaaaattcccttactttatggtta |
1445029 |
T |
|
| Q |
217 |
atttgattcaccaaatttaagatatgactgc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1445028 |
atttgattcaccaaatttaagatatgactgc |
1444998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 179 - 243
Target Start/End: Complemental strand, 1453187 - 1453123
Alignment:
| Q |
179 |
ttcaatttgccaaacaaaattcccttactttatggttaatttgattcaccaaatttaagatatga |
243 |
Q |
| |
|
||||||||||||| | |||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1453187 |
ttcaatttgccaaccgaaattctcttactttatggttaatttgattcaccatatttaagatatga |
1453123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 293
Target Start/End: Complemental strand, 1444986 - 1444955
Alignment:
| Q |
262 |
atcatgaatatttaactattatgtctcaagaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1444986 |
atcatgaatatttaactattatgtctcaagaa |
1444955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University