View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_75 (Length: 297)
Name: NF9444_low_75
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_75 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 292
Target Start/End: Complemental strand, 9413829 - 9413542
Alignment:
| Q |
5 |
aaccgatgggtagcatgggccattaaccgaaacaatgatctcacatcttccatgaatggagcacaagctttggttgcaattccacaatctagtggaactc |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9413829 |
aaccgatgggtagcatgggctattaacccaaacaatgatctcgcatcttccatgaatggagcacaagctttggttgcaattctacaatctagtggaactc |
9413730 |
T |
 |
| Q |
105 |
ctaaagcttatacttcatcaattgccggttcagggacacaattagcagagagtaatattagttatcctcattcaaggttgagtgctacacatgaaaataa |
204 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
9413729 |
ctaaagcttatacttcatcaattgccaattcaaggacacaattagcagagagtaatattagttatcctcattcagggttgattgctacacatgaaaataa |
9413630 |
T |
 |
| Q |
205 |
cgaggttacgatttatgcaagtattactcttcctgttggaactacttctttggttcatctttggcaagatggtgctatctctgcttct |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
9413629 |
cgaggttacgatttatgcaagtattactcttcctgttggaactccttctttggttcatctttggcaagatggtgctatgtctggttct |
9413542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University