View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9444_low_82 (Length: 281)
Name: NF9444_low_82
Description: NF9444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9444_low_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 260
Target Start/End: Complemental strand, 7902717 - 7902469
Alignment:
| Q |
12 |
agcagaacctgtgtcattgctagctggcaactgtggaaggatgggttggacagtgtttgggatgtctttgtattgaagtatagctgtagcagttttgttg |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902717 |
agcaaaacctgtgtcattgctagctggcaactgtggaaggatgggttggacagtgtttgggatgtctttgtattgaagtatagctgtagcagttttgttg |
7902618 |
T |
 |
| Q |
112 |
tcaacttgaattggggcatccataaaagccttggtggccacaaagtacctaccagcaacttgattggcatgaaccagaacgtttgtggtttgaccaggag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902617 |
tcaacttgaattggggcatccataaaagccttggtggccacaaagtacctaccagcaacttgattggcatgaaccagaacgtttgtggtttgaccaggag |
7902518 |
T |
 |
| Q |
212 |
caattagtatagcctgagtggtgaatggttttgtataaacagcatcaac |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902517 |
caattagtatagcctgagtggtgaatggttttgtataaacagcatcaac |
7902469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 261
Target Start/End: Complemental strand, 7892269 - 7892195
Alignment:
| Q |
187 |
agaacgtttgtggtttgaccaggagcaattagtatagcctgagtggtgaatggttttgtataaacagcatcaact |
261 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| || | || || |||||||||||||| ||||| ||||||||| |
|
|
| T |
7892269 |
agaacatttgtggtttgaccaggaccaattagaatggattgtgttgtgaatggttttgtgtaaactgcatcaact |
7892195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University