View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9445_1 (Length: 710)

Name: NF9445_1
Description: NF9445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9445_1
NF9445_1
[»] chr7 (1 HSPs)
chr7 (11-125)||(1579538-1579652)
[»] chr4 (3 HSPs)
chr4 (11-106)||(48847850-48847945)
chr4 (21-118)||(7588015-7588112)
chr4 (16-80)||(46784856-46784920)
[»] chr2 (1 HSPs)
chr2 (11-118)||(26790985-26791092)
[»] chr6 (1 HSPs)
chr6 (16-83)||(12646362-12646429)
[»] chr5 (1 HSPs)
chr5 (16-83)||(23621002-23621069)
[»] scaffold0214 (1 HSPs)
scaffold0214 (28-118)||(8631-8721)
[»] chr3 (1 HSPs)
chr3 (11-89)||(23424194-23424272)
[»] chr1 (1 HSPs)
chr1 (11-84)||(5193430-5193503)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 2e-48; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 11 - 125
Target Start/End: Original strand, 1579538 - 1579652
Alignment:
11 gatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagggtcagccttgggtatgag 110  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
1579538 gatgaacaaggactttggtgatgattttgtagatgatattgcataggctaatggggcgaaagtctttgtaagtggtgggagggtccgccttgggtatgag 1579637  T
111 ggctatgaaagtgtc 125  Q
    |||||| | ||||||    
1579638 ggctataagagtgtc 1579652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 84; Significance: 2e-39; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 11 - 106
Target Start/End: Complemental strand, 48847945 - 48847850
Alignment:
11 gatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagggtcagccttgggta 106  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||    
48847945 gatgaacaaggactttggtgatgattttgtagaagatgttgcataggctaatggggcaaaagtctttgtaagtggtgggagggtcggccttgggta 48847850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 118
Target Start/End: Original strand, 7588015 - 7588112
Alignment:
21 gactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagggtcagccttgggtatgagggctatga 118  Q
    |||||||||||||| |||||| |  |||||||| ||||||||||| |||||||||||  | || |||||||||||||  ||||| |||||||| ||||    
7588015 gactttggtgatgagtttgtacacaatgttgcaaaggctaatgggtcgaaagtctttaaatgttgtgggagggtcagttttgggaatgagggcaatga 7588112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 46784856 - 46784920
Alignment:
16 acaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgta 80  Q
    ||||||||||||||||||||||||||| | |||||||| ||||| || || | ||||||||||||    
46784856 acaaggactttggtgatgattttgtaggttatgttgcaaaggctgataggtctaaagtctttgta 46784920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 11 - 118
Target Start/End: Complemental strand, 26791092 - 26790985
Alignment:
11 gatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagggtcagccttgggtatgag 110  Q
    |||| ||||||||||| ||||| ||||||||||||||||| || ||||||||||| | ||||||||| || ||    ||||||||| | ||||| |||||    
26791092 gatggacaaggactttagtgataattttgtagatgatgttacaaaggctaatgggtctaaagtctttataggttaaaggagggtcaactttgggaatgag 26790993  T
111 ggctatga 118  Q
    ||||||||    
26790992 ggctatga 26790985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 12646362 - 12646429
Alignment:
16 acaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagt 83  Q
    |||||||||||||| |||||||||||||  |||||||| ||||||||||| |  || |||||||||||    
12646362 acaaggactttggtaatgattttgtagacaatgttgcaaaggctaatgggtctgaaatctttgtaagt 12646429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 23621002 - 23621069
Alignment:
16 acaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagt 83  Q
    |||||||||||||| || ||||||||||| |||||||| ||||| ||||| || || |||||||||||    
23621002 acaaggactttggtaataattttgtagattatgttgcaaaggcttatgggacggaaatctttgtaagt 23621069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0214 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0214
Description:

Target: scaffold0214; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 118
Target Start/End: Complemental strand, 8721 - 8631
Alignment:
28 gtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagggtcagccttgggtatgagggctatga 118  Q
    ||||| ||||||||||||||||| || ||||||||||| | |||||||||| | ||   |||||||||| | ||||| || ||||||||||    
8721 gtgataattttgtagatgatgttacaaaggctaatgggtctaaagtctttgaaggttaagggagggtcaactttggggataagggctatga 8631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 89
Target Start/End: Complemental strand, 23424272 - 23424194
Alignment:
11 gatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtggg 89  Q
    |||| ||||| ||||| ||||| || |||||||| ||||||||||| || ||||| | ||| |||||||||||||||||    
23424272 gatgcacaagaactttagtgataatcttgtagattatgttgcatagacttatgggtctaaaatctttgtaagtggtggg 23424194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 84
Target Start/End: Original strand, 5193430 - 5193503
Alignment:
11 gatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtg 84  Q
    |||| ||||| ||||| ||||| || |||||||| |||||||| ||||| ||||| | ||| ||||||||||||    
5193430 gatgcacaagaacttttgtgataatcttgtagattatgttgcagaggctgatgggtctaaaatctttgtaagtg 5193503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University