View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9445_14 (Length: 324)
Name: NF9445_14
Description: NF9445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9445_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 137 - 295
Target Start/End: Complemental strand, 28191080 - 28190922
Alignment:
| Q |
137 |
aaaaatgaagaagtcatattggctataagagttaggtgtcatcttattaaaatgtagatatcacatcaatgtaaattcgtggaaaactgaattgggacta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28191080 |
aaaaatgaagaagtcatattggctataagagttaggtgtcatcttattattaaaatgatatcacatcaatgtaaattcgtgcaaaactgaattgggacta |
28190981 |
T |
 |
| Q |
237 |
ccaaattgtaaagaggaaaactataagcacccaagattgctaaaaagatatgtggaacc |
295 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28190980 |
ccaaatcgtaaagaggaaaactataagcacccaagattgctaaaaagatatgtggaacc |
28190922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 15 - 80
Target Start/End: Complemental strand, 28191196 - 28191136
Alignment:
| Q |
15 |
aaaattcaattctcatatcaaaagttaactcgcacaactgagagtacatcaaatctctaatcaagg |
80 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
28191196 |
aaaattcaattctcatat-----gtcaactcgcacaattaagagtacatcaaatctctaatcaagg |
28191136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University