View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9446_high_3 (Length: 340)
Name: NF9446_high_3
Description: NF9446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9446_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 24291181 - 24290854
Alignment:
| Q |
1 |
agtctaactttgacaagatcagtaggatttgccaccgcaattgccacagcacctgtcgataagacaaattcagagggttcaatatcataattttgcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24291181 |
agtctaactttgacaagatcagtaggatttgccaccgcaattgccacagcacctgtcgataagacaaattcagagggttcaatatcataattttgcatta |
24291082 |
T |
|
| Q |
101 |
tatatcgagagttttagaaaaaactgaatgggattaattaccagttgttagtgcagcaagaannnnnnnngtcaacggagcatctccaacatggtctttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24291081 |
tatatcgagagttttagaaaaaactgaatgggattaattaccagttgttagtgcagcaagaattttttttgtcaacggagcatctccaacatggtctttc |
24290982 |
T |
|
| Q |
201 |
ccaacatacaaattcttaacctgttcaattccaaagtaattaacacatcagattgcatatgcaaaaaattagatatgaactcaaacaaatgaacaatctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24290981 |
ccaacatacaaattcttaacctgttcaattccaaagtaattaacacatcagattgcatatgcaaaaaattagatatgaactcaaagaaatgaacaatctt |
24290882 |
T |
|
| Q |
301 |
tcagacacggttgattactcacaggttc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
24290881 |
tcagacacggttgattactcacaggttc |
24290854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 5773565 - 5773620
Alignment:
| Q |
1 |
agtctaactttgacaagatcagtaggatttgccaccgcaattgccacagcacctgt |
56 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
5773565 |
agtcttactttgacaagatcagttggatttgccaccataattgccacagcacctgt |
5773620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University