View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9446_low_11 (Length: 276)
Name: NF9446_low_11
Description: NF9446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9446_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 66 - 247
Target Start/End: Original strand, 53335117 - 53335299
Alignment:
| Q |
66 |
gtcttaagtgttgtatttgttacaaaaggtttccagtacgtataagtgggccacttttcttacgtagcaatgcttaaaacaacaaaacaacatagccacg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53335117 |
gtcttaagtgttgtatttgttacaaaaggtttctagtacgtataagtgggccacttttcttacgtagcaatgcttaaaacaacaaaacaacatagccacg |
53335216 |
T |
 |
| Q |
166 |
ggtatatctgccccgttggaattattatgtaaacaaaatat-tcatggaccattcttacattgaattagaaaatcttatccct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53335217 |
ggtatatctgccccgttggaattattatgtaaacaaaatataacatggaccattcttacattgaattaaaaaatcttatccct |
53335299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University