View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9446_low_13 (Length: 273)
Name: NF9446_low_13
Description: NF9446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9446_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 36475394 - 36475289
Alignment:
| Q |
1 |
cacattaaacacataggtcgaacctattggtgtataaaattcatatagacaattgtaattggtgtatataatttatttagtggatccaatttgtattcta |
100 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36475394 |
cacattaaacacataggttgaacctgttggtgtataaaattcatatggacaatagtaattggtgtatataatttatttagtggatccaatttgtattcta |
36475295 |
T |
 |
| Q |
101 |
attatt |
106 |
Q |
| |
|
| |||| |
|
|
| T |
36475294 |
actatt |
36475289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 190 - 220
Target Start/End: Complemental strand, 36475237 - 36475207
Alignment:
| Q |
190 |
agcacatctaagttgacatggacaatacaat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36475237 |
agcacatctaagttgacatggacaatacaat |
36475207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University