View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9446_low_19 (Length: 250)
Name: NF9446_low_19
Description: NF9446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9446_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 48897478 - 48897679
Alignment:
| Q |
1 |
caccataatgaacgaatcaactaaccatctcgcaagtagcttttatggttacttatgcattttgttggtgaagttcacgtgaatctgaagcattttgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48897478 |
caccataatgaacgaatcaactaaccatctcgcaagtagcttttatggttacttatgcattttgttggtgaagttcacgtgaatctgaagcattttgtta |
48897577 |
T |
|
| Q |
101 |
ataatatgaattaaattaaattttgaaacgcaccggtcactctgatacccatatttattgtcgggaaatgatagatacaacaacaaactatatcaagaat |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48897578 |
ataatatgaattaaataaaattttgaaacgcaccggtcactctgatacccatatttattgtcgggaaatgatagttacaacaacaaactatatcaagaat |
48897677 |
T |
|
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
48897678 |
tt |
48897679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 235
Target Start/End: Original strand, 48897698 - 48897726
Alignment:
| Q |
207 |
aacatcttttcttaattacacaccattat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48897698 |
aacatcttttcttaattacacaccattat |
48897726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University