View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9446_low_20 (Length: 249)
Name: NF9446_low_20
Description: NF9446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9446_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 75 - 195
Target Start/End: Original strand, 15821558 - 15821681
Alignment:
| Q |
75 |
gtatctcaccgtgtttgtgcctagttattattatttgtttgattgtttaatccattgttttg------ggtttctaaatttgcagtctgcatcaagttgt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
15821558 |
gtatctcaccgtgtttgtgcctagttattatt---tgtttgtttgtttaatccattgtttcgcagtacggtttctaaatttgcagtctgcatcaagttgt |
15821654 |
T |
 |
| Q |
169 |
tcgaggaaattctactcaatcaaagtg |
195 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
15821655 |
tcgagggaattctactcaatcaaagtg |
15821681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 192 - 240
Target Start/End: Original strand, 15821704 - 15821752
Alignment:
| Q |
192 |
agtgttgccgtggctgcgatttcatcataaagagaattggtggtctctg |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| || ||||| |
|
|
| T |
15821704 |
agtgttgccgttgctgcgatttcatcataaagagaattggcggcctctg |
15821752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 192 - 240
Target Start/End: Complemental strand, 23641259 - 23641211
Alignment:
| Q |
192 |
agtgttgccgtggctgcgatttcatcataaagagaattggtggtctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23641259 |
agtgttgccgtggctgcgatttcatcataaagagaattggtggcctctg |
23641211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University