View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9446_low_20 (Length: 249)

Name: NF9446_low_20
Description: NF9446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9446_low_20
NF9446_low_20
[»] chr7 (2 HSPs)
chr7 (75-195)||(15821558-15821681)
chr7 (192-240)||(15821704-15821752)
[»] chr8 (1 HSPs)
chr8 (192-240)||(23641211-23641259)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 75 - 195
Target Start/End: Original strand, 15821558 - 15821681
Alignment:
75 gtatctcaccgtgtttgtgcctagttattattatttgtttgattgtttaatccattgttttg------ggtttctaaatttgcagtctgcatcaagttgt 168  Q
    ||||||||||||||||||||||||||||||||   |||||| |||||||||||||||||| |      ||||||||||||||||||||||||||||||||    
15821558 gtatctcaccgtgtttgtgcctagttattatt---tgtttgtttgtttaatccattgtttcgcagtacggtttctaaatttgcagtctgcatcaagttgt 15821654  T
169 tcgaggaaattctactcaatcaaagtg 195  Q
    |||||| ||||||||||||||||||||    
15821655 tcgagggaattctactcaatcaaagtg 15821681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 192 - 240
Target Start/End: Original strand, 15821704 - 15821752
Alignment:
192 agtgttgccgtggctgcgatttcatcataaagagaattggtggtctctg 240  Q
    ||||||||||| |||||||||||||||||||||||||||| || |||||    
15821704 agtgttgccgttgctgcgatttcatcataaagagaattggcggcctctg 15821752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 192 - 240
Target Start/End: Complemental strand, 23641259 - 23641211
Alignment:
192 agtgttgccgtggctgcgatttcatcataaagagaattggtggtctctg 240  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||    
23641259 agtgttgccgtggctgcgatttcatcataaagagaattggtggcctctg 23641211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University