View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9446_low_24 (Length: 241)
Name: NF9446_low_24
Description: NF9446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9446_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 77 - 221
Target Start/End: Complemental strand, 15821208 - 15821064
Alignment:
| Q |
77 |
acttggaattattaatggcaacgtgaattcaaatgggtaaataaagccaaactgagattaaatttctatggaaaataagggttcttaaactatcatgtaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15821208 |
acttggaattattaatggcaacgtgaattcaaatgggtaaataaagccaaactgagattaaatttctatggaaaataagggttcttaaactatcatgtaa |
15821109 |
T |
 |
| Q |
177 |
attacggctgctaaagattcaaaagaaataacaaaataaaactga |
221 |
Q |
| |
|
| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15821108 |
actgcggctgctaaagattcaaaagaaataacaaaataaaactga |
15821064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 6 - 78
Target Start/End: Complemental strand, 15821559 - 15821487
Alignment:
| Q |
6 |
acacgaacagtagcgcatcaaatttctttcaatggattgatgggattaagcagcagcaatgaacaagtaatac |
78 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15821559 |
acacgaacagtagcgtatcaaattgctttcaatggattgatgggattaagcagcagcaatgaacaagtaatac |
15821487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 16549141 - 16549202
Alignment:
| Q |
118 |
taaagccaaactgagattaaatttctatggaaaataagggttcttaaactatcatgtaaatta |
180 |
Q |
| |
|
|||||||||||||| ||| ||||||| | ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
16549141 |
taaagccaaactgaaattgaatttctctcgaaaataagggttctgaaactat-atgtaaatta |
16549202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University