View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9447_high_9 (Length: 238)
Name: NF9447_high_9
Description: NF9447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9447_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 9 - 116
Target Start/End: Complemental strand, 13770577 - 13770470
Alignment:
| Q |
9 |
ggacatcatcatcatggacttttggacttctgaagacatggttgatcccatccgtcacctgctttataactaagaaactaataattattattgcaaaaat |
108 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770577 |
ggacagcatcttcatggacttttggacttctgaagacatggttgatcccatccgtcacctgttttataactaagaaactaataattattattgcaaaaat |
13770478 |
T |
 |
| Q |
109 |
ggaccacc |
116 |
Q |
| |
|
|||||||| |
|
|
| T |
13770477 |
ggaccacc |
13770470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 13770423 - 13770357
Alignment:
| Q |
163 |
aaatttcgtgactgtataaactatgttgtttgtgttcttcctttatggtgttgtctcctttgcttct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
13770423 |
aaatttcgtgactgtataaactatgttgtttgtgttcttcctttatggtgttgtctcttttgtttct |
13770357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University