View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9447_low_11 (Length: 322)
Name: NF9447_low_11
Description: NF9447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9447_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 2181500 - 2181817
Alignment:
| Q |
1 |
agtgtaaatctgtaaccacatctttgttttcttcacatgtagttggagattgtgatgtctactccaggtgtgtttgaggtcggtaacc-----taacctt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||| ||||||| |
|
|
| T |
2181500 |
agtgtaaatctgtaaccacatctttgttttcttcacatgtagttggagattgtgatgtctaccccaggtgtttttgaggttggtaaccgaacctaacctt |
2181599 |
T |
 |
| Q |
96 |
atttgcttcctcactttccttatttttgaggtttaaatttcgtaatttgcttcttgtttgtgtaggttctacagcagctggtgaaggatcatccaagatt |
195 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||| ||| | |
|
|
| T |
2181600 |
atttgcttcctcacttttcttgtttttgaggtttaaatttcgtaatctgcttcttgtctgtgtaggttctacagcagctggtgaaggagcatcctagaat |
2181699 |
T |
 |
| Q |
196 |
aactctaggggtatgatttcattctttaagtgtctttttgatttctcacatttcatcaatgttatatcaaatgagcc-----gaagtttatgaatgtgga |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| || |||||||||||| ||| | |
|
|
| T |
2181700 |
aactctaggggtatgatttcattctttaagtttctttttgatttctcacatttcatcagtgttatatcaaatgaaccgaactgaagtttatgaacgtgaa |
2181799 |
T |
 |
| Q |
291 |
aaaaatatcattatgctc |
308 |
Q |
| |
|
||| ||||| |||||||| |
|
|
| T |
2181800 |
aaagatatcgttatgctc |
2181817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University