View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9447_low_17 (Length: 240)
Name: NF9447_low_17
Description: NF9447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9447_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42500125 - 42499898
Alignment:
| Q |
1 |
cgattgcttagtataattatcaatattttttgctctaacttaattcaggaaaggttacttcttgaagaaaataaacgcttatgcaagcaggttagtctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42500125 |
cgattgcttagtataattatcaatattttttgctctaacttaattcaggaaaggttacttcttgaagaaaataaacgcttatgcaagcaggttagtctct |
42500026 |
T |
 |
| Q |
101 |
ttaattatgaaagattaacagaaacataactaaataa---taattaaatgtaatcacaagtgt--gtcacccgacatgcctttattaaaagcttaatttt |
195 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42500025 |
ttaattatgaaagattaacataaacataactaaataatagtaattaaatgtaatcacaagtgtgcgtcacccgacatgcctttattaaaagcttaatttt |
42499926 |
T |
 |
| Q |
196 |
ccattgtttttcaccttgattaaaagaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42499925 |
ccattgtttttcaccttgattaaaagaa |
42499898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University