View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9447_low_18 (Length: 240)
Name: NF9447_low_18
Description: NF9447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9447_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 24709558 - 24709765
Alignment:
| Q |
15 |
cagagagcttagtctcatgaagaatgagannnnnnngtttagttttcttacgtactaggatttgaacgatcacattgtttacctttcccttacgtacttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24709558 |
cagagagcttagtctcatgaagaatgagatttttt-gtttagttttcttacgtactaggatttgaacgatcacattgtttacctttcccttacgtacttg |
24709656 |
T |
 |
| Q |
115 |
tatcatgagaaatataagatgcgttggaacctggaatcgtccaaagtaattggtcatgctaatcggttatgcttcctatt-ggtatattgcaacaacacc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24709657 |
tatcatgagaaatataagatgcgttggaacctggaatcgtccaaactaattggccatgctaatcggttatgcttcctattctgtatattgcaacaacacc |
24709756 |
T |
 |
| Q |
214 |
atttattgt |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
24709757 |
atttattgt |
24709765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 66 - 128
Target Start/End: Complemental strand, 30509679 - 30509617
Alignment:
| Q |
66 |
gtactaggatttgaacgatcacattgtttacctttcccttacgtacttgtatcatgagaaata |
128 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
30509679 |
gtactaggatttgaacggtcacaatgtttacctttgtcttatgtacttgcatcatgagaaata |
30509617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 30510010 - 30509982
Alignment:
| Q |
15 |
cagagagcttagtctcatgaagaatgaga |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30510010 |
cagagagcttagtctcatgaagaatgaga |
30509982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University