View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9448_high_8 (Length: 240)
Name: NF9448_high_8
Description: NF9448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9448_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 97 - 210
Target Start/End: Original strand, 34256628 - 34256740
Alignment:
| Q |
97 |
tgttcaatttttcccagttttgagtcattatttgg-aactaagtacaatttttgctactatcttcactcctttggacattttttgaaataaatctatctt |
195 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| | |||| |
|
|
| T |
34256628 |
tgttcaatttttcccagtt--gagtcattatttgggaactaagtacattttttgctactatcttcactcctttggactttttttgcaataaatttgtctt |
34256725 |
T |
 |
| Q |
196 |
tctatatatccgtat |
210 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
34256726 |
tctctatatccgtat |
34256740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University