View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9448_low_17 (Length: 261)
Name: NF9448_low_17
Description: NF9448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9448_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 44010342 - 44010570
Alignment:
| Q |
23 |
attctcttttttgagaattattgtatatatccacgaaccaaaagatttgggattcttcatcaatttgtagtatcaactcaaggatagagagaatgtcaac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44010342 |
attctcttttttgagaattattgtatatatccacgaaccaaaagatttgggattcttcatcaatttgtagtatcaactcaagggtagagagaatgtcaac |
44010441 |
T |
|
| Q |
123 |
ttcaaagtaaatttgctagaaagataagatataattagggtgatggtaagttagtgaatgtcacactttcatatctaatgataatagtttgtaaatttaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44010442 |
ttcaaagtaaatttgctagaaagataagatataattagggtgatggtaagttagtgaatgtcacactttcatatctaatgataatagtttgtaaatttaa |
44010541 |
T |
|
| Q |
223 |
ctcgatatacacaaattgaattccctatg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44010542 |
ctcgatatacacaaattgaattccctatg |
44010570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University