View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9448_low_29 (Length: 244)
Name: NF9448_low_29
Description: NF9448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9448_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 43632133 - 43631932
Alignment:
| Q |
20 |
gaagacaaaacttagcattcatttgttgaagaatgcttttcctacgatgcttcacttcagcatatttcaaacgtaacgagagagctcggtgatgttttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43632133 |
gaagacaaaacttagcattcattt--------atgcttttcctacgatgcttcacttcagcatatatcaaacgtaacgagagagctcggtgatgttttgt |
43632042 |
T |
 |
| Q |
120 |
ggcagagaagtgggtcacagaaaaatgaaag-------nnnnnnnncagagatattctcactaattagggaacagtaaagacaaaagaaagaaggaacca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43632041 |
ggcagagaagtgggtcacagaaaaatgaaagaaaaaaaaaaaaaaaaacagatattctcactaattagggaacagtaaagacaaaagaaagaaggaacta |
43631942 |
T |
 |
| Q |
213 |
gacctgcacg |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
43631941 |
gacctgcacg |
43631932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University