View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9448_low_32 (Length: 241)
Name: NF9448_low_32
Description: NF9448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9448_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 222
Target Start/End: Complemental strand, 45521898 - 45521686
Alignment:
| Q |
10 |
tagattatacttattaagatctggtgattttgctattgccaatacaataggaggaacaacaggtgcaactgttactccatgtttgttaacaagattcaag |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521898 |
tagatcatacttattaagatctggtgattttgctattgccaatacaataggaggaacaacaggtgcaactgttactccatgtttgttaacaagattcaag |
45521799 |
T |
 |
| Q |
110 |
aatgaatttatatcgaattttggcatcaagagaatggtagctttggctctgagtccacagagcaaaacagagtttagtgaataaatatgaaacagaggaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521798 |
aatgaatttatatcgaattttggcatcaagagaatggtagctttggctctgagtccacagagcaaaacagagtttagtgaataaatatgaaacagaggaa |
45521699 |
T |
 |
| Q |
210 |
gcacacaaagtat |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45521698 |
gcacacaaagtat |
45521686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University