View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9448_low_42 (Length: 235)
Name: NF9448_low_42
Description: NF9448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9448_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 15171477 - 15171267
Alignment:
| Q |
1 |
caacttcattggtaatttcagaagatgaaatgggtcttgatggtctttttactgctacaggtttaccacgaacaattgctttgtagacataaccatgact |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15171477 |
caacttcattggtgatttcagaagatgaaatgggtcttgatggtctttttactgctacaggtttaccacgaacaattgctttgtagacataaccatgact |
15171378 |
T |
 |
| Q |
101 |
tcctttgccaagaagtttgttgtctgagaaattgtttgttgcagcttcaaggtcactgtattgaaactgttggatcttgatggttttttctttgttctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15171377 |
tcctttgccaagaagtttgttgtctgagaaattgtttgttgcagcttcaaggtcactgtattgaaactgttggatcttgatggttttttctttgttctct |
15171278 |
T |
 |
| Q |
201 |
ttgttcggttt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
15171277 |
ttgttcggttt |
15171267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University