View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9449_low_19 (Length: 242)
Name: NF9449_low_19
Description: NF9449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9449_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 37806705 - 37806499
Alignment:
| Q |
18 |
actcattcaccacttaattttttctttatgtttttcctcttatcaaaacacttatcaatcagattgtgattatgtttcttttctctcaaattgaacatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
37806705 |
actcattcaccacttaattttttctttatgtttttcctcttatcaaaacacttatcaatcagattgtgattatgtttcttctctctcaaattaaacatgg |
37806606 |
T |
 |
| Q |
118 |
ggtgtatgaatgtacattattttccaaataaaaaacgataaacacttttaaatgacctggtacaacaggaatacattaggagtttaggaccacaagttga |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
37806605 |
ggtgtatgaatgaacattattttccaaataaaaaacgataaacacttttaaatgagctggtacaacaggagtacatttggagtttaggaccacaagttga |
37806506 |
T |
 |
| Q |
218 |
tacgtct |
224 |
Q |
| |
|
||||||| |
|
|
| T |
37806505 |
tacgtct |
37806499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University