View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9450_high_1 (Length: 345)
Name: NF9450_high_1
Description: NF9450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9450_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 38683936 - 38684221
Alignment:
| Q |
1 |
tgcttttggtgcttcttctacacacgctttcggtggtggttcttcccccttctcaacacctttctctgctcaactacaaccccaacaacagcagcagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38683936 |
tgcttttggtgcttcttctacacccgctttcggtggtggttcttccctcttctcaacaccgttctctgctcaacaacaaccccaacaacagcagcagcaa |
38684035 |
T |
 |
| Q |
101 |
cagcagaattcactctttcaactatcaccttctactggttttgggtttcagaattctacgccagcgccgcaaccttcgccgtttccaaattctcaattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684036 |
cagcagaattcactctttcaactatcaccttctactggttttgggtttcagaattctacgccagcgccgcaaccttcgccgtttccaaattctcaattga |
38684135 |
T |
 |
| Q |
201 |
ctactcaaatggctaatgttgctccagttccattctcactggcggatcgtgatattcaagtattattttttcactacactgttcaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684136 |
ctactcaaatggctaatgttgctccagttccattctcactggcggatcgtgatattcaagtattattttttcactacactgttcaa |
38684221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 4160599 - 4160521
Alignment:
| Q |
206 |
caaatggctaatgttgctccagttccattctcactggcggatcgtgatattcaagtattattttttcactacactgttca |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
4160599 |
caaatggctaatgttgctccagttccattctcaccgaaggatcgtgatattcaagtattat-ttttcactatactgttca |
4160521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 36 - 92
Target Start/End: Complemental strand, 7895175 - 7895119
Alignment:
| Q |
36 |
gtggttcttcccccttctcaacacctttctctgctcaactacaaccccaacaacagc |
92 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
7895175 |
gtggttcttccctcttctcagcaccgttctctgctcaacaacaaccgcaacaacagc |
7895119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University