View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9450_high_7 (Length: 318)

Name: NF9450_high_7
Description: NF9450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9450_high_7
NF9450_high_7
[»] chr6 (1 HSPs)
chr6 (92-304)||(21879771-21879985)


Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 92 - 304
Target Start/End: Original strand, 21879771 - 21879985
Alignment:
92 aaggataatcaacaactattgtcaaccaccacca----caccatagcatcctctctagccatctcttctgatcatgtaccgatcaatttccnnnnnnnta 187  Q
    |||||||||||||||||||||||||||||| |||    |||| |||||||| |||||||||||||||||||||||||||||||||||||||       ||    
21879771 aaggataatcaacaactattgtcaaccacc-ccagtttcaccgtagcatccgctctagccatctcttctgatcatgtaccgatcaatttccaaaaaa-ta 21879868  T
188 tttgcaaatccatcctttatatagtgaatgatgatgtgcannnnnnnaaaaattaaaactagaaattttctcccataataataacattgagagttcccca 287  Q
    ||||||||||||||||||||||||||||||||||||||||        ||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
21879869 tttgcaaatccatcctttatatagtgaatgatgatgtgcattttttataaaattaaaactataaattctctcccataataataacattgagagttcccca 21879968  T
288 aatatgctccaataaat 304  Q
    |||||||||||||||||    
21879969 aatatgctccaataaat 21879985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University