View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9450_low_25 (Length: 318)
Name: NF9450_low_25
Description: NF9450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9450_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 92 - 304
Target Start/End: Original strand, 21879771 - 21879985
Alignment:
| Q |
92 |
aaggataatcaacaactattgtcaaccaccacca----caccatagcatcctctctagccatctcttctgatcatgtaccgatcaatttccnnnnnnnta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
21879771 |
aaggataatcaacaactattgtcaaccacc-ccagtttcaccgtagcatccgctctagccatctcttctgatcatgtaccgatcaatttccaaaaaa-ta |
21879868 |
T |
 |
| Q |
188 |
tttgcaaatccatcctttatatagtgaatgatgatgtgcannnnnnnaaaaattaaaactagaaattttctcccataataataacattgagagttcccca |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21879869 |
tttgcaaatccatcctttatatagtgaatgatgatgtgcattttttataaaattaaaactataaattctctcccataataataacattgagagttcccca |
21879968 |
T |
 |
| Q |
288 |
aatatgctccaataaat |
304 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21879969 |
aatatgctccaataaat |
21879985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University