View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9450_low_40 (Length: 242)
Name: NF9450_low_40
Description: NF9450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9450_low_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 7564469 - 7564329
Alignment:
| Q |
1 |
tgttgctttgagttttttgctatttttctacatattggtcctgttctctgtaatatttatttactgtcatgaatttatattgtttcattctctatgagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7564469 |
tgttgctttgagttttttgctatttttctacatattggtactgttctctgtaatatttatttactgtcatgaatttatattgtttcattctctatgagca |
7564370 |
T |
|
| Q |
101 |
ttagcaatcacccaattgttgcattcacagattccattgat |
141 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7564369 |
ttagcaatcacccaattgttccattcacagattccattgat |
7564329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 187 - 242
Target Start/End: Complemental strand, 7564330 - 7564275
Alignment:
| Q |
187 |
attgatactattaacctttatcttgctaattaatgagaggtggttatgcctatgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
7564330 |
attgatactattaacctttatcttgctacttaatgagaggtggttatgcttatgct |
7564275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University