View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9450_low_40 (Length: 242)

Name: NF9450_low_40
Description: NF9450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9450_low_40
NF9450_low_40
[»] chr6 (2 HSPs)
chr6 (1-141)||(7564329-7564469)
chr6 (187-242)||(7564275-7564330)


Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 7564469 - 7564329
Alignment:
1 tgttgctttgagttttttgctatttttctacatattggtcctgttctctgtaatatttatttactgtcatgaatttatattgtttcattctctatgagca 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7564469 tgttgctttgagttttttgctatttttctacatattggtactgttctctgtaatatttatttactgtcatgaatttatattgtttcattctctatgagca 7564370  T
101 ttagcaatcacccaattgttgcattcacagattccattgat 141  Q
    |||||||||||||||||||| ||||||||||||||||||||    
7564369 ttagcaatcacccaattgttccattcacagattccattgat 7564329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 187 - 242
Target Start/End: Complemental strand, 7564330 - 7564275
Alignment:
187 attgatactattaacctttatcttgctaattaatgagaggtggttatgcctatgct 242  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||    
7564330 attgatactattaacctttatcttgctacttaatgagaggtggttatgcttatgct 7564275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University