View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9451_low_19 (Length: 231)
Name: NF9451_low_19
Description: NF9451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9451_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 7465446 - 7465641
Alignment:
| Q |
17 |
atcaagggcggactcagccaaattatggcacgtgcatccannnnnnncagaggtgtttttcaaagtctgtcagttgctggataatggagttttggcctca |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7465446 |
atcaagggcggactcaggcaaattatggcacgtgcatccatttttttcagaggtgtttttcaaagtctgtcagttgctggataatggagttttggcctca |
7465545 |
T |
|
| Q |
117 |
ttttgcatggttttatggagtctttggaatagaagaaatacaaaagtattggatggcttgcaaaaagattactctcaggcactggctatggcatat |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7465546 |
tttcgcatggttttatggagtctttggaatagaagaaatacaaaagtattggatggcttgcaaaaagattactctcaggcactggctatggcatat |
7465641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University