View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9452_low_6 (Length: 207)
Name: NF9452_low_6
Description: NF9452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9452_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 12 - 120
Target Start/End: Complemental strand, 38385855 - 38385747
Alignment:
| Q |
12 |
aagcagagacgtgaacatgatgaaaatatagtcgctttgcctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgtgatc |
111 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38385855 |
aagcaaaggcgtgaacatgatgaaaatatagtcgctttgcctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacagacactgcaattgtgatc |
38385756 |
T |
|
| Q |
112 |
acaccattg |
120 |
Q |
| |
|
||||||||| |
|
|
| T |
38385755 |
acaccattg |
38385747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 12 - 107
Target Start/End: Complemental strand, 29439074 - 29438979
Alignment:
| Q |
12 |
aagcagagacgtgaacatgatgaaaatatagtcgctttgcctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29439074 |
aagcaaagacgtgaacatgatgaaaatatagtcgctttgcctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgt |
29438979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University