View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9453_low_31 (Length: 277)
Name: NF9453_low_31
Description: NF9453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9453_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 49 - 259
Target Start/End: Complemental strand, 42248587 - 42248376
Alignment:
| Q |
49 |
ggtgcattttttgccttggggaatgtcaatccagctgcagaagcaaatgtaagtcgaagcttatttgctttggatctttctattgatgttttgtaagata |
148 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42248587 |
ggtgcattttttgccttggggaacgtcaatccagctgcagaagcaaatgtaagtcgaagcttatttgctttggatctttctattgatgttttgtaagata |
42248488 |
T |
 |
| Q |
149 |
gaggttatataagtatgacagtaatttgggttggtattttgtgaaaaagcaactatagctg-gctgtagctctacaacacatcggaatttgaataaacca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42248487 |
gaggttatataagtatgacagtaatttgggttggtattttgtgaaaaagcaactatagctgcgctgtagctctacaacacatcggaatttgaacaaacca |
42248388 |
T |
 |
| Q |
248 |
ctattgtctgtg |
259 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42248387 |
ctattgtctgtg |
42248376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University