View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9453_low_33 (Length: 254)
Name: NF9453_low_33
Description: NF9453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9453_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 40270225 - 40269993
Alignment:
| Q |
1 |
tgtgtgattattgtttctccttcctattcacttggtgtcttattctctcatcgagtctatgtaactcgcccgtttcctttcattctttttcttcagattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40270225 |
tgtgtgattattgtttctccttcctattcacttggtgtcttattctctcattgagtctatgtaactcgcccgtttcctttcattctttttcttcagattc |
40270126 |
T |
 |
| Q |
101 |
gtaggttgcagaataggtatttccttatacttgtagatttgccaagagttccttcattttggtttgtctatatattaagtggtgatcattattttgcaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40270125 |
gtaggttgcagaataggtatttccttatacttgtagatttgtcaagagttccttcattttggtttgtctatatattaagtggtgatcattattttgcaac |
40270026 |
T |
 |
| Q |
201 |
tttaagacgatgcaactattttggtatgaagtt |
233 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
40270025 |
tttaagatgatgcaactattttggtatgaagtt |
40269993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 86 - 160
Target Start/End: Complemental strand, 40262955 - 40262880
Alignment:
| Q |
86 |
tttttcttcagattcgtaggttgcagaataggtatttccttatacttgtagatttg-ccaagagttccttcatttt |
160 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| |||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
40262955 |
tttttcttcagattcactagttgcagaatgagtattcccttctatttgtagatttgtccaagagttccttcatttt |
40262880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University