View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9453_low_40 (Length: 241)
Name: NF9453_low_40
Description: NF9453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9453_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 101 - 235
Target Start/End: Complemental strand, 54213273 - 54213139
Alignment:
| Q |
101 |
cgaaaccaaacagttacacctataaacgaacaataaaccataagttttatttgacaacaaaacaaatagctacgattttannnnnnnnaagaaatataac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
54213273 |
cgaaaccaaacagttacacctataaacgaacaataaaccataagttttatttgacaacaaaacaaataactacgattttattttttttaagaaatataac |
54213174 |
T |
|
| Q |
201 |
tgaattttctttagtaaaccattgagttttagtgt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
54213173 |
tgaattttctttagtaaaccattgagttttagtgt |
54213139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 54213358 - 54213300
Alignment:
| Q |
16 |
cacaaccaaacatacactnnnnnnntcaacataaatccgtacttgacacattgttacag |
74 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54213358 |
cacaaccaaacatacactaaaaaaatcaacataaatccgtacttgacacattgttacag |
54213300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University