View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9453_low_42 (Length: 239)
Name: NF9453_low_42
Description: NF9453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9453_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 31691493 - 31691716
Alignment:
| Q |
1 |
aatctcaagcagaatctgagctttcaaatgctaaaaagacaatgaaaaatctctcttctatgattgaggaatcaagttacaaggctaaggcgaaaatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31691493 |
aatctcaagcagaatctgagctttcaaatgctaaaaagacaatgaaaaatctctcttctatgattgaggaatcaagttacaaggctaaggcgaaaatgaa |
31691592 |
T |
|
| Q |
101 |
ggacatagaaacactagagaagaagggaaaaggtcaacatggtgctatggttgtaaggaggaatgagaattatgagtatgcacaagtgatgagagaattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31691593 |
ggacatagaaacactagagaagaagggaaaaggtcaacatggtgttatggttgtaaggaggaatgagaattatgagtatgcacaagtgatgagagaattg |
31691692 |
T |
|
| Q |
201 |
gaatatctcaaaaaggaattgttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31691693 |
gaatatctcaaaaaggaattgttt |
31691716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University