View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9455_low_3 (Length: 351)
Name: NF9455_low_3
Description: NF9455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9455_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 7e-40; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 137 - 232
Target Start/End: Complemental strand, 2833073 - 2832978
Alignment:
| Q |
137 |
ggtgcacctccgaccccgtctgtggggttggggcgttatcctaggtggtggtttgttggagtgtcgttttgacggctatatggtgtattgtacatc |
232 |
Q |
| |
|
||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833073 |
ggtgcgcctccgaccctgtctgtgggattggggcgttatcctaggtggtggtttgttggagtgtcgttttgacggctatatggtgtattgtacatc |
2832978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 264 - 341
Target Start/End: Complemental strand, 2832946 - 2832867
Alignment:
| Q |
264 |
gccatacaaaagaagaagaaaaa--tgagtcgacggcttgccaattggacccatctaagctgtaaattccttcatctctg |
341 |
Q |
| |
|
||||||||||||||||| ||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2832946 |
gccatacaaaagaagaaaaaaaaaatgagtctacgccttgccaattggacccatctaagctgtaaattccttcatctctg |
2832867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 52
Target Start/End: Complemental strand, 2833203 - 2833158
Alignment:
| Q |
5 |
ccggtgtggctcccaggctttcctctttgtctttttgttgtttgcagg |
52 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
2833203 |
ccggtgtggctcccaaactttcctct--gtctttttgttgtttgcagg |
2833158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University