View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9455_low_8 (Length: 245)
Name: NF9455_low_8
Description: NF9455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9455_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 6419999 - 6419756
Alignment:
| Q |
1 |
gaagaagggtcaaaatactattttcattcaagtttgaagagtnnnnnnnnn-gtggcacagtgacagagtcacagttacagagaggagcggcaatggcat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6419999 |
gaagaagggtcaaaatactattttcattcaagtttgaagagtaaaaaaaaaagtggcacagtgacagagtcacagttacagagaggagcggcaatggcat |
6419900 |
T |
 |
| Q |
100 |
gcatgcagagagcacagctatgctaattgacccaactttgctttgactccattactattactattattatt---------------attaacaaacaaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
6419899 |
gcatgcagagagcacagctatgctaattgacccaactttgctttgactccattactattacttttattattattattattattattattaacaaacaaag |
6419800 |
T |
 |
| Q |
185 |
caatgggaatgagctggcgacattgattgatcaaagttagtact |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6419799 |
caatgggaatgagctggcgacattgattgatcaaagttagtact |
6419756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University