View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9456_low_17 (Length: 213)
Name: NF9456_low_17
Description: NF9456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9456_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 90 - 200
Target Start/End: Original strand, 17749473 - 17749583
Alignment:
| Q |
90 |
aagtcaagaagaaaatagggaaagaatacaaaaaggtgattgtgatgtgtttaatttggttggattaaaattttctttgcgtttaactttatgtgctatg |
189 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17749473 |
aagtcaaggagaaaatagggaaagaatacaaaaaggtgattgtgatgtgtttaatttggttggattaaaattttctttgcgtttaactttatgtgctatg |
17749572 |
T |
|
| Q |
190 |
cttttggatgt |
200 |
Q |
| |
|
||||||||||| |
|
|
| T |
17749573 |
cttttggatgt |
17749583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University