View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9457_high_3 (Length: 236)
Name: NF9457_high_3
Description: NF9457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9457_high_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 45 - 236
Target Start/End: Complemental strand, 32707368 - 32707171
Alignment:
| Q |
45 |
acgttcacttggaatgaagcagatgaggttgtcactgatgagttggctgaagagtgatttgatggattcttcttagctcagtgattttccagaactcatt |
144 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32707368 |
acgttcacttggactgaagcagatgaggttgtcactgatgagttggctgaagagtgatttgatggattcttcttagctcagtgattttccagaactcatt |
32707269 |
T |
 |
| Q |
145 |
gtgaatcaaaacatacaatgattcaaggtt------acttgttaatttaatcaaagaaacaagttaaagagttccataggagggatgattttgaggta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32707268 |
gtgaatcaaaacatacaatgattcaaggttgataacacttgttaatttaatcaaagaaacaagttaaagagttccataggagggatgattttgaggta |
32707171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 236
Target Start/End: Complemental strand, 16895264 - 16895230
Alignment:
| Q |
202 |
ttaaagagttccataggagggatgattttgaggta |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
16895264 |
ttaaagagttccataggagggatggttttgaggta |
16895230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University