View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9458_low_7 (Length: 240)
Name: NF9458_low_7
Description: NF9458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9458_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 45649264 - 45649042
Alignment:
| Q |
18 |
tgtatctctttcaaatcttttataaatgataattgttgatgtattattgtctatatttatannnnnnnngtcagtcatacgttttttgtatcagcaatgt |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
45649264 |
tgtatctctttcgaatcttttataaatgataattgttgatgtattattgtctatatttatattttttttgtcagtcatacgttttttgtattagcaatgt |
45649165 |
T |
|
| Q |
118 |
ctacatatccgtaattttaacaagtccagtgtctgtctatgtactcatgtatgtgtccgagtcttgtgcttagtagttcaaaaacgaaaaatctttggca |
217 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45649164 |
ctacatatccgtagttttaataagtccagtgtctgtctatgtactcatgtatgtgtccgagtcttgtgcttagtagttcaaaaacgaaaaatctttggca |
45649065 |
T |
|
| Q |
218 |
acaattgcccaattttgagcccc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45649064 |
acaattgcccaattttgagcccc |
45649042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University